EST 898209 is a singleton


Sequence

>898209 (1 EST) Length=322 AATTATGTCGTACGAAGTATCAGGAGAATCTAAGGGTAATGAGGAAAATCTACCGGTAAAGGATAAAGATAAGTGTACGG AAGAAAAAGATGACAAGAACGCGATAATAGCTGGTTTACAGCAACTTCGTGAGCAGCAAAGAAATATTGTAGTGGAGTTA GCACGAGTAGAAGACGATNAACGTGAACATGAACGTGTGATTCAAGTGTTAAAAAAGATGGAAGGTGATAGAAAATGCTT TCGAATGGTAGGCACAACTTTAGTGCANCATGAAATTAAAACTGTATTGCCCATTTTGGAATCTACATTACAAAATCTGG AT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898209: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8982091892814AA257312MB4SLM1E6T3Brugia malayi L4 JHU93SL-BmL4


Date: 7:15:40 on Mon 20 Nov 117.