EST 898264 is a singleton


Sequence

>898264 (1 EST) Length=142 ATGTCTGAAGTTCCTGATGTCTCACAGAATCTGACCGACCAACTTATCGGTGGATTTTTCCCGTTGTCCGTACAACGATG AAACTTTGTACATGGATACTGAACATAGCCGTTCTACCCCGTCATTTACAATGCACGATTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898264: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8982641892869AA257393MB4SLM2D7T3Brugia malayi L4 JHU93SL-BmL4


Date: 1:47:58 on Sat 18 Nov 117.