EST 898281 is a singleton


Sequence

>898281 (1 EST) Length=195 CTTATGCATGTTGGAAGCGGACAGTGTTGAACCACCGAAGGAAACTATTACAAACGAACTTTCGATCTTGTCAAACAATA TTACGAATTGTCTTTCGGCGTTTTCATTAAAGCTTGGCTGTCACACAGAGACGGTAAGTTGTGTTGAAGAGTGCGTCATT GCCGCTGAAGAGTTGTACACATTGGGCGGATTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 898281: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8982811892886AA257247MB4SLM2F2T3Brugia malayi L4 JHU93SL-BmL4


Date: 8:56:41 on Tue 21 Nov 117.