EST 898300 is a singleton


Sequence

>898300 (1 EST) Length=76 GAGGAAGCAGGTGTGTTCATACCTCTTATTCATTGAATTTGGGTGGAATAGGAAGAAGACGTTCAGGCTATAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898300: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8983001892905AA257338MB4SLM2G12T3Brugia malayi L4 JHU93SL-BmL4


Date: 2:33:7 on Sat 25 Nov 117.