EST 898304 is a singleton


Sequence

>898304 (1 EST) Length=117 TATCTACTTTTATATTTAGCCTCATCAATGTCCTCACCAACATACCAATGACCTATCTTACCATCCCTTGATCATATGCA CTCTAAATACTCCTGTACTGGACATGCCATATTCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898304: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8983041892909AA257407MB4SLM2H4T3Brugia malayi L4 JHU93SL-BmL4


Date: 18:31:15 on Sat 18 Nov 117.