EST 898354 is a singleton


Sequence

>898354 (1 EST) Length=429 CTCAGATCACCATTCTTCTGCATGTTGTTCATCTGTTTTACAGTCCTATCATTTCTTTTCATACAGGCTAATGCTTCTCA AGAGAACGAAACGAATTCCATTATAGACAAATCATTAATCGATTTATCAAATGAAGATTGGAGCAACTGGAGTGAATGTT CAGATTCATGCGGTGGATGTGGCATACAAAACCGTACGCTAATCTTTCCAAATGGTACGCATATTGTACACGTCCGCCAC TGTAACCTGAAACCATGTATGGATGAAGAGGAACTGTGCTGTGAACCATTTAAATTCATAAATGAAAAGTGCTTGGTACC GGAAAAAATTCAAAATAAAACAAAAACCGATGATTTAGAAGACCAGAAAAAGGAAGCAGTAGATGCTTGGAGAAGTATTA NAGAAGATGACCAGTCGAAATTTAATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898354: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8983541892959AA257483MBAFCZ0E2T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:55:30 on Sun 19 Nov 117.