EST 898360 is a singleton


Sequence

>898360 (1 EST) Length=398 GAGGATTAAAAGAGACTGAAAAAGAATCTTTCCTCCACAATAAAAGAAAGCTGTGAAGAATTTTCTACTGTACCTGAATA GAAAAAAGTTTGTCTGTTATGGACGCAGAAATAAAAGAAGGGCCAAATTGTTACGAGAATCAACTACGAGCCATGTCGAT GTGTCGGTCTGGATTTGACCCAGTGGGTTCAAACGGCTTCATATCCAGTTGTTCGCATCAATTAGTAACATGCCCAACGT TATCGATGACAATTGCCAAGCAAAAGGACCAGCAGATAGTGCATCCGTTTCATCCATGCAGTTTCGTCTCCTTTGCGCAA CATTTCTCAACGCTGTCTTTCAACAGCAACAGTACTACGCCCTCAACCTCCTCTTCATCGTCATTCCCAGCACCAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898360: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8983601892965AA257489MBAFCZ0E9T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:14:22 on Fri 24 Nov 117.