EST 898383 is a singleton


Sequence

>898383 (1 EST) Length=122 AAGACAACATGGAAGCGATGTTCTCGTTGGTAGTTCTTTTGCTTTTCATCTCGCCTACTTGTTATGGAACTCTCGAAATT AGTGGTGACGAGCTGCTGCTAAAAACTCATGGCACTGTGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898383: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8983831892988AA257317MBAFCZ0G12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:15:8 on Fri 24 Nov 117.