EST 898416 is a singleton


Sequence

>898416 (1 EST) Length=384 TGAGTATGGTGGATACTGATAGGAGTCAGGCATTAAAACTGCTGTTGCTTGGCCTGACAATGGTAATTACGGGATCAGCT AATACTATTGCAGCAAAATGGGCTGATAGCATGAAGGCGGATAACAGACATTTCAACCATCCATTTGTTCAGGCAATCTG CATGTTTATCGGTGAACTGTCATGCTTGTTTGTTTATATCATTGCACGCTACATTCAAAATCATCGCGATCAAACATCAT CATATAGTGATGAAGGCAGTGAAAGCGGTATACCCAGATATATTTCAGAAAAAAATCCTTTGAAACTTAATCCTTATGTA TTCGCTGTACCAGCATNTTGTGATGTTCTTGCAACCTCGATAATGTATATTAGCTTAAATCTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898416: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8984161893021AA257519MBAFCZ1B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:40:6 on Sat 25 Nov 117.