EST 898440 is a singleton


Sequence

>898440 (1 EST) Length=356 AAAAGGATTTCTAAAAGTACTTTATACCGAAAAATAACATGTGTTGTACTCCGCTTGTTGTTTTGGTGATTTGTAAACAT ACATTATTTGCATTTTGTATATTTTCTGAACTTTTTTGTGTCATTTATATATCTTCACATCAGTCCTAGACTGTGTTCCA TATTCATCTCCGTTCGTTGATTTAATTTCAAGCTGGTTTCAAATGGTACTGTTTAATGCAAGTCTTCGAATAAAACACAT ATTTTCAGGTAATATTAATAACTAATTGCATATATCTTCTCTCTTATTGCATAAAACTACTTCCTTCCGTTTCGGTGTAT TGCGGAGTCTATAATTGCTGTGAATAAATGCTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 898440: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8984401893045AA257569MBAFCZ1E1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:53:49 on Fri 17 Nov 117.