EST 898441 is a singleton


Sequence

>898441 (1 EST) Length=401 CAAGTTTGAGTTTCCTAGAGAAGGCAATTGGATGTTTATACGTTATGCTTCACCAATTCATGCCCAGCAAGCTCTTTCTC GAAATGGACAAATTATGGATGGTCGATTGCGTTTAGGAGTAGTTCCAGTTGATAATCAGGAGTTGATGAATTTAGAGGAT GATGACTATTTGAACATATTTTCACAAACAAATAATGAAAATAGTAATCAGTTCAGCCGTAATGGGTCTATTTTGTCTGA AGTATCCTTTTTTTGTGAAAATGACCCGTCAACAATTACACTCTCATGTCCTCTGGATACAAGTTTCAATCCTTCATTAA TTGCGTCACCTGTTCGTGGAGGAATTCGTTCTNTACGTGCTTCTTTCAACGCGGTAGATAATTATTACCGGGTTGATGAT G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898441: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8984411893046AA257570MBAFCZ1E2T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:28:32 on Sat 18 Nov 117.