EST 898444 is a singleton


Sequence

>898444 (1 EST) Length=193 GTTGGAGAACATGCTCCATTCATGTTTCCCCAAATAAATTTTAAGTTTTATTATTATTACTAATTACTTTTATTATTATA CTGTTATTAATTAATTAAGTTTAATTGTAACATTTCGACTTTTTTTTCTATTTACTTGTTCCTCTAGTTAGCTAGCTTTA ATATTACGGCTTGTTAATAAATTTTTTTTACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 898444: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8984441893049AA257573MBAFCZ1E5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:46:28 on Fri 17 Nov 117.