EST 898451 is a singleton


Sequence

>898451 (1 EST) Length=205 AGTTGGTGGAACAATCTCATTTCAGTCAGACTATGTAACTCACTTCGTAAAGAGAGCAAACTTGTTCGAAAGGGATCAGG AGTGAAGTGTATTGCATATTTATTTTGTCGATTTTACTTTCCTTTGTTTAATATCATATGAAATAATCGTCATTGCTGTT ATAAATTCAATTTGTGATACAACAATAATAACGCTTGTAGTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 898451: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8984511893056AA257580MBAFCZ1F1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:43:4 on Fri 24 Nov 117.