EST 898454 is a singleton


Sequence

>898454 (1 EST) Length=205 GAGAGAGAGAGAGAAAAACAATATCTGAAAATGAAGAGCAAAAGAAAGCTACCAAAACAGTATTTGCAGATTCGGATTAA TCGGCCTGTGTTGTATTGTTGACCCATTGATTCTTCTCATTTTTTACTGAATCCATTCTTGATCATTTGTTATTTGTTAA TGTCAATCATCTCTAATGAAAATAAAACATGCTTGTACCGTTNAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 898454: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8984541893059AA257583MBAFCZ1F4T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:13:36 on Sun 19 Nov 117.