EST 898489 is a singleton


Sequence

>898489 (1 EST) Length=278 CCTGAGTCTTTCAAGAGTTTGGTTATGTTGACAAAGCAAATGGCAGTCGAGGATGGACGTCCGGTAGTCACAGATGAAGA GCAAATGAACGTGCATACTGACCAATCATTATTTGGTACTCCATTCGAACACTCCAAAGTGTTTCCTCGGGGAGCTGCAG AGAATCACCAAAAACCTCCGAGATCCACTCAAAATTACGGAATATTAAGTCACGAAATATAAATTCGATGTTTTGTTCCA CCATTTCTTTTTTTGTAAAAATGATATATGTCCAATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898489: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8984891893094AA257423MBAFCZ2A6T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:40:58 on Sat 18 Nov 117.