EST 898520 is a singleton


Sequence

>898520 (1 EST) Length=338 TATCGTGTATGGACAACCTCACCTCTTCCATCTCTCCCTTCCACCTTCCGTTTCCTTCACCTCGTCTTGCCATTTCTACA CCAGCAACCTCTTGAAATCAATTACCCGAAACTGATTTTCACCTCCAACGTATCACACTACTCCTTTCACTGCTCACACA GAAACGGTTTACAACTTTTTGTACGAATTATTGTACACCGGTTGTTCATGGGCCGATTTCAGAGACTTTCGATGCATGAT GGTAAGCGATCCATAATATATTTACTGGATGGATCACAACTGGAGCTTACTATTCAACCACGATTATTTGTTCATGAATT GTTAAATATTATTGCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898520: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8985201893125AA257623MBAFCZ2D10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:8:6 on Fri 24 Nov 117.