EST 898633 is a singleton


Sequence

>898633 (1 EST) Length=252 TACTTTGGAAGTAAGAATATCAAAGGCTCAATTGCTTGACAAGGAAATTGGAAGGCGATGTGTTTTCGAACCACAGAGAC CTATAGCTTCATGGATGCGTAATGACGTTATATTTATTTATACACCTGCGCTCATATGCGAATTCCCNTCCATAGCAGTC GGTGTTGATGATGCCGTCTCAGCTACCGGACTTATATTCTCGCAATTTTATCGATGTTCTACCTGGTCAATCGATATAAT TATATGGCATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898633: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8986331893238AA257748MBAFCZ3G4T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:47:42 on Fri 17 Nov 117.