EST 898642 is a singleton


Sequence

>898642 (1 EST) Length=330 GACTGCGGCCAGGTGGCAGTACCTCTAACACATGTTCGAAATTTTCGTGGATTAGGCAATTGTTCGATATGTTGTGATTC GCATATGAAAATTGTTGTGCAGTTGAATTGCCATCATCAAACATGCGTGGATTGTTTCTCAACCTATATCAAAACAGCTT TTGTTGAACATCAGTTTGCATTTATGCCGCCAAATGGTTACACTGTTGGTTGTCCTGTTTACAACTGTCGTGGATGTGTT GTCGACACACATTGTTTTTATCTGATGGGCAAATCGACTTATGACGAATATCAGCGGCAAGCAGCAGAACATTTTATTAC GCTGGAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898642: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8986421893247AA257757MBAFCZ3H1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:0:24 on Sun 19 Nov 117.