EST 898659 is a singleton


Sequence

>898659 (1 EST) Length=325 TTCATTTCAACTTCTTTTGTGTAGCCGTTGTCTCACTTACGATTGTCTTATCCATGCAAGATGATCCCTAGGCGTCAATG CAACAGAGACGGAAGTCCGGCGACGTCGTGGAGTAACAAGTGTTGAACCTTGTGGACTGCAGTGTTTTAGGCATTTGACG AAAGAAATGGAGGAAGCGAAACGCCGCTGTGCTTCTCCACCAGATGCGAAAACGATAAATGCCATATTAAATATAAAGAC TGAGGACATCAACTGGACAGCACAACAAGAATCAATGTTCATTGCTTTGCGCCGTACATACAAAAATGATTTCTGTAAAT TATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898659: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8986591893264AA257774MBL2SJ3A7T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 14:9:36 on Mon 20 Nov 117.