EST 898663 is a singleton


Sequence

>898663 (1 EST) Length=103 TGTGCATATTAACGGATGGTTATCAAATGGTCGCTAAAATGATACTATCAATAATTTCATTGATTTACTGATTAATTACT GTAATTTGATTATTATTTCATCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898663: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8986631893268AA257778MBL2SJ3B1T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 16:23:23 on Sat 18 Nov 117.