EST 898689 is a singleton


Sequence

>898689 (1 EST) Length=422 TAAAAGTTTGGTTACAAATTATCACAATCCATACAACTTGACATTCATATGCACATTTGAAATTCATATTGTTTCATCAT TTGGAATGTCAAAAATTCATAACAACATTATCAATTAATTAATCTTCAAGGAATAATTCCTTCACCAACAGCTCATTAGC ACACTGTTCACCAGACAACCTCTTTGCCTTATTGCTATAATCCAGTAATGTGGGAATTTCTTTTAGTTTAAATCTCTGAT CAGTTCGAAATGCATTTGTTTGATCTTTCCAGCACGTCCGTGGTCCAACAGCGCATTCGATAAATGTCAAATCTATGTCC GTATCATTAGAAGATACAATTTGTTCAATAACTTTCTCAATTACAGGTTCCGCTTGAACACAATCTGGACACCAACTTTT GCCACCATCTTTTGAACCGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 898689: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8986891893294AA257804MBL2SJ3D7T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 17:11:52 on Wed 22 Nov 117.