EST 898700 is a singleton


Sequence

>898700 (1 EST) Length=108 GAAGTGTAATGGGAGCGGATGGTGGTACAATCCCGAAACGTTGTGAGCTTGTAAAAAAAAAAAAAAAAAAACCCCCCAAG GAGACGCCCGGTCCCCATTCCCCCCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 898700: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8987001893305AA257530MBL2SJ3E10T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 2:27:10 on Wed 22 Nov 117.