EST 898702 is a singleton


Sequence

>898702 (1 EST) Length=138 TTTGCTATTTGCTTGTGTACAAAAGGGCAGTTTGTGTGACACGAAGTACTGCCTTTTTGAGTAAAACGAAAGAAATTGGT GTAAAAAGACAGTAACAGCTATATGATTATTATTCTATAGCTATTGTANAGAAAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898702: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8987021893307AA257532MBL2SJ3F1T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 23:45:53 on Sat 18 Nov 117.