EST 898720 is a singleton


Sequence

>898720 (1 EST) Length=264 ATTATGAATTAGAGAGGGGCATTGTTGTCGAGGTAAAAGAAAGCTTTACAACAAATGCACCTACTTGGAGTTGATAATGT TCGTATTCCTGACAAGTGCTTTTTGTCCCAAACTATCGGAATTATCACTTTTTGTCATCAAATCACCGCCATACTATCTC TTATAAGCTGCTTGCAAAGAGAAAAGTAGCTTGAACAAGTTAATTTGAAGGCTATACCATGAATGGTAGAGTTTTTCCGA AATGCTGTTGTGTTATCGAGATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 898720: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8987201893325AA257809MBL2SJ3G9T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 4:38:52 on Sat 25 Nov 117.