EST 898733 is a singleton


Sequence

>898733 (1 EST) Length=72 GATAGATTATATTGAAACCAGTTTGGATACATAGCTATTTGCTTCTTTTATCAGTCAACCAATTATGGCGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898733: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8987331893338AA257822MBL2SJ3H11T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 18:22:44 on Sat 18 Nov 117.