EST 898738 is a singleton


Sequence

>898738 (1 EST) Length=97 AGCAATTAACGTCACATCGTGCTAATATGTTATTATGATCAAACAATCATCCAAGAGCGCACAAAAATATAATTAGCGCA TTTTGCTGTGTTAGCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 898738: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8987381893343AA257827MBL2SJ4A4T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 2:53:23 on Tue 21 Nov 117.