EST 898757 is a singleton


Sequence

>898757 (1 EST) Length=109 TCGTTTAATACTTTACTTGGATAAGTAATCTCCGTTGTTGTCGTCGATTGTTTTTTACCTCAAACTTGGGTAATTAAACC CGGAATTCCGGGTTTAATTACCCAAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 898757: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8987571893362AA257846MBL2SJ4C1T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 9:5:14 on Tue 21 Nov 117.