EST 907655 is a singleton


Sequence

>907655 (1 EST) Length=434 GTCGATGACTGCATCGCGGTAGTTGGATTGATAATTGCTATATAGCGCTAAATGTTTGCCAGTGATTTTACTGTCGTAAT TTTATCACTGTTTCCATTGTTAACATTCGGTACAACTAAAATGACGTTGAAGTCCTGTTCCGAATTGCTCATGGGACATA CAGGTATTGGTGTGAAGACCTGTAATCTCACCGATCACGCAGCTTCCTGAAACCTGTGAGAAGGATAACTCTATTACAGT TGTTTGTGAAGTGGCAAATGAAATTAATTGTATAGGATTGGACAACGGCACAAGGAAGTTTCTGAAACGTGTACCAAATG GCTGTGCCTATTCAGCTGGTGTTTGATTATAGTATTGCACTATTGTTATCAGTATTTCTCGGCTGGTTAGCATTGATCGA ATTTATCTTGGATATTATGCCTATAGAATTCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 907655: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9076551902760AA266672SW3ICA2358SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 8:13:31 on Wed 22 Nov 117.