EST 907661 is a singleton


Sequence

>907661 (1 EST) Length=462 GNAGATATGCAAGGGAAAGAGCATCGTTACATCCATATCAAGCATTTAATGCAAATGCTGATGCTGAAACATTACGTAAA GCAATGAGAGGTTTAGGTTGTGACAAAAATAAAGTTATTATTGTACTTTGTGGCAGAGTTAATTTTCAGCGTCAACAAAT TGCGGCAGCTTATAAAACAATGTATGGTAAAGATCTTATAAATGATTTGAAAAGTGAGCTATCAGGTGATTTTGAAGATT TAATATTGGCGCTAATGGAACCACCAGCACGATATGATGCGCAACAACTTCCACAAAGCTATGCAAGGTTTGGGTTACAA AAGAACCAGTACTAATTGAAATTATGTTGTTCCCGGACGAATTGCCCAAATTATTGAATTACGTTAACATTTATCCAGCA AATGTTATCCATTCCAACCGTTTTAGAGAATGATTTTAATTGGGTTGAAACCAAGCCGGACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 907661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9076611902766AA266678SW3ICA2364SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 19:18:31 on Fri 24 Nov 117.