EST 907666 is a singleton


Sequence

>907666 (1 EST) Length=485 GCAAGTCGAAGAAACTGAAATCAAGTGCCGGCGATTTGATTTCCAAGTCAACACTTCCATTGGATCTGCAAATTGAACAG AATAAACGTGAAAGTGGGCGTGGCACAGCACGAGTGAAACAACGAAAATTGAAACGCACCAAACCGGATGATGAGTACAT CGATGAATCACTATCAAGTAAAATTCTTAAAACAGCTTGGAAGCAAAAACAAGATATAGAAGCAGTGGAGAAAACACAAG TAGAAAATATGATACACGAGGATGCATTAAAAAGGATACGAAAAGTAATCTTGGAAATGATTCCAGTAAGTTCTCTGTCG GATGGCGATATCGTCTCTGATAATGACGATTATGACAATTTTTCCTATGCAAATAAATCCGGAAAGAATGAAGCCAGCAG TCCGAAAATTTTTATATTTAAAAACTGGATGCTGTATCCCCCGGACACTTTAACGAATATCCCTTAATTTGGAAAAGAAT TTGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 907666: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9076661902771AA266683SW3ICA2369SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 11:17:57 on Sun 19 Nov 117.