EST 910007 is a singleton


Sequence

>910007 (1 EST) Length=575 GAAAGACAAATTTTGTTGAAAAGTTTGACAAATTGTCTTTGCTCATTTAAGTTATTTTCAGTCGGCTAAATCGGATATTT ATGATTATGACTGTCGTCGTGATGATTTGGATAAATCAACTGAGACTGAAGGAATGGATAGTTTTATTGAAGTCTATGAA AAATTTGATGATTTCCTTTCGAAACTGAATGTTCCATCGTCAATTGTTTTGAGTGGCAGTAGTTCTTCGAGCGATGGTGA TAATTTCATTGTGGACACTTTTTTCGGAGATATGCAGAGGAACGTCCCGAGAATTTCGAGTTGATAGACGCCGATTTTCC GAAAGAACATCCGCGATCAGCGGAGCATGCTTCCAGCACACTGTGGTAAGGCTGAATTATCCTCCAGTAATTGATCCACC TAAAATTATTACTCCCCGAATGAAATCCCAGGCTACCCTTGAAAACAGTTTATTTAAAATTTATGTTCCAATACTAATTC CGTTTAAGAATGGATTTCCTATAACTGAGGTGCTCCTGAAGAATGTTGAATACATTTGACATAATTTAAACGTTGCAGTT TTTGTTCTTTTTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 910007: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100071906072AA269004SWMFCA1781SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:0:1 on Tue 21 Nov 117.