EST 910015 is a singleton


Sequence

>910015 (1 EST) Length=652 CTAATTTGGATAGAAGAGAATTTCAAGATTTTATACATCGTACTGAACCAATCATCAAGGGTCTTCGTCTTCTTCGCTCA AATAATACTAAAACATTCACTGCAAATGGCTTATCCAAGCAACCGGTGATGTATCTTAGAAATGGGCGAATGCCACCACT AACGGAAGCATATAAAAGATTGGGAATTAATATCAGGCCTGATTTGCCGGCTGTTGTTATCAAATCACGCTCTGGTATAG GTTTTTTCCCTTTTGAAATTTTATATGTTACTCCAAATCAAAAAGTTCCAGATTCAAAGCTTCGATCAGATCAAAGGCTA ACTGTAATGAAGATTCAGTTGTAGCTCCACATATACGACATGAAGAAATAGAACGACATATGGCAGCATTAAATTTGAGT TGAAAGCACATTCAATCCAATTTTAGCATCATTCGGTATTCGAATTAGTAAAAGCCCAATGGTGGTTGAAGCTAATCCCG TATACCACCACCAATTCCTTACAGTCCCGAAATGTTTCCATGAATGTTGCACCCAAATAAGGCTAGCTTGGAACGCCTGG AAATAATCCATTTTACAATCCCAGCCAAAATTGATAATTTTATTTGTTTTATGAATAGGGATTGCAATGAAAATTCCTTA AGAATTCCTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 910015: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100151906080AA269012SWMFCA1798SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:32:58 on Mon 20 Nov 117.