EST 910026 is a singleton


Sequence

>910026 (1 EST) Length=651 CCAAGTTTGAGGTGTTGGAAAACTTCTGCAATTACAAATGGAGGATCGTGATGATGGTATCGGATCGGAAATACATACTC CAAGAGATGCTCAGAGTGCCGAGGAATCACATCGTAATCCTGTTGTCCAAGAAAATGAGGGTGTAAATGGAATTGGTATT CTGATAGCATCGTATCCGGCACTGTCGGTTTCTACAAACACTTCGACGCCAATCAGACCACAAAATCAGCAAATTTCCCA TCACGTCCCAGGGATATCACCAATTCGAACAGTTCCACAAGTTAAAATGTGGAGATGGCGACGCGACAACTGTTTTAGAC TGTTCGAAGGGTTGAAACGAATTAATGGACTTGTTCGGTGATAAGCAGTACACTAAATTAGATTTGGCTGTGATGCTGCG CGACAAACATTCGGAATGTTTTGGGTTTGGAGAGAGAGAATGAACGGTTGTCCACAATTAATCCGAAAGGCTTTACAAAT TGAAAATCCTCCATTCCCAGAACCAGGTTTCCCGCCTCCAAAGGAACCATGCTGCAACTTTTGGCCCAAAGAAATTGGAA AAACCTGAAGGAATTTTGCGGAAAAAAATGAATCCCAATTTGTTGGAATGCCACCTCCCATTNCAAATTNCCCAACCCAA AATTTTCCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 910026: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100261906091AA269023SWMFCA1821SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:20:25 on Sat 18 Nov 117.