EST 910028 is a singleton


Sequence

>910028 (1 EST) Length=627 ATCTTGAGTATTAATCGAATTAATGGCGGACGACGAATTGGAAACTTATAAGCTGTGGAGAGTTCGAAAGACAGTTATGC AAATGTGCCATGATCGCGGATATTTGGTAACGCAAGAAGAATTGGATCAAACACTGGAAAATTTCAAAGAAACCTTTGGT GATAAACCAAGTGAACGACATCCATCCCGTAATGAATTAACTGTTTTGGTAGCACATAACGATGATCCAACAGATCAGAT GTTCGTCTTTTCCCGGAAGATTCTAAAATTGGGATCAAAACAATTAAGGCGATCTGTCAACAANTGCAGGAACAGGCAAT ACACGTGCAATTATGGTCGTACAACTGGTTTGACTCCATCAGCTAAGCAGGCAATACCAATTTGGCCCAAATNCCCTTGG GAACAGTCCCTAAAANCGAACTCCTGGTTATTTTACTGGACCCAAATTGGGTCCCGGACCTTTTTTCTTGGACAACCGAA AGAAAAGAACGAATTNCTNGGGTCCGAATATAAGCCTCCAAGATTACACCGTTACCCCCGAATTCCCGCAAATTGATCCG GGTTNCTGGTTTTTCGGTTTACAACAAGACANTTTTCCAAATTATCNACNCCCAAACTGCTGGAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910028: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100281906093AA269025SWMFCA1823SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:14:2 on Wed 22 Nov 117.