EST 910031 is a singleton


Sequence

>910031 (1 EST) Length=669 TCAGTTTTTAGAAGAGCNTCGATNTNGTNTCTCTTTCACTTTTCCGCTGACTGGTGTGTGTAGTTGTTGTGGTTGGGTGC TTTGTGTACGCCATGAGTTTGAGTCCGGAATTATTCCGGTTGCCGGATCGATCATCGGGACAGCATAGTATGACAATACG AGAACTTTGTGACAATGATGATATGGCAACAAGCATTATCGTCGATCCGATTCTGGGTTTTCGCACACATAAAATGAATC TTCATTATCGTCCACCGCAACACGAGGAACAAATTAAGCTGAAGTGCATATTGAGGAAATATAAGGAGGATCAGGATTTG TGCGCAGCGATTCAAGAAATTTTCCATGTTGAGTTGCAATAACGAGATTTCTGAAACGACGGACGCTAAAGCAGCAGCTT GCTTTCCCGAGATCACCTCCTTGAAGTTTATGCGAATGTTTTCCCAACGACTCCAGCTTTACAGTCCAAGCGTTGTTTAT CCGTTACAAAACNGAAAATCCCCCTTGGGTGGAATGGCTAGTTTGCTACGAAAATCCCTGGCAAAAGGGTGATGTTCCTT GGGCAGTTTAATGGGTTGTTTTATTGGTGATCTCCCTCCCCACGAAGAATCCCCCATTGCTGAAAAAGAAATCAAGAATT TCCCGTCCCGTTTTAGTACCAGAAAGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 910031: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100311906096AA269028SWMFCA1826SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 23:54:59 on Sat 18 Nov 117.