EST 910035 is a singleton


Sequence

>910035 (1 EST) Length=264 GTGATATTATTATTAATGGTGAAGTTAACTATTCACGCTTGTCGCGTTCGTGAACATCGGCATATAGAGTATGCTCGTTT GCCAACGTATATTGAAGCAATGAATGTGAAGGTCCCATTGTACGAAGATGTCATAAAATGTGAGAAGTCATCCGAAAAAG GCCCAATTGATGCCTAACCTCTACAAATTATTTGAGAATATTTTCGTTTTTTTCAATAATTGTGATAAACACATTATTCT GTTGTCATCATCATAACACTCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910035: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100351906100AA269068MA1MA003.AA3S. mansoni adult Lambda Zap


Date: 18:1:52 on Fri 17 Nov 117.