EST 910038 is a singleton


Sequence

>910038 (1 EST) Length=220 GTTTGTATGGGAGAGAGAGAGGTTGGAAGCTGATCCATCCAACTTTTGCGTAAAGATTATTCTACTCCAAACGAAAGATT GTCTTCTGTGATATTTTTGGTGTTTTGCCTACCAACATATGTCAGAAGTCAATACAATTAAAAGACAAAATTAACATTTG CAAGTATTATGACAGCATATATGTATCTTAAAGATCTTAAAGATCTATTTTNNNTCATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910038: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100381906103AA269071MA1MA006.AA3S. mansoni adult Lambda Zap


Date: 0:54:48 on Wed 22 Nov 117.