EST 910044 is a singleton


Sequence

>910044 (1 EST) Length=258 ATTTGATTGAGCTTTTATGTCGACAGTTACAAAAGACCATCTCAGCAGCCATCTGGAAAAAAGAAGGAGATCGCGAGTCG TGGTGTTAAACATGAACTTACAGAAGACCAAAAACAAGAAATCCGTGAAGCATTTGACCTTTTTGACACTGATAAATCAG GAACAATCGATATCAAAGAGTTAAAAGTTGCTATGCGGGCTCTTNNTTTCGAACCAAAAAAAGAAGTAAGTGAGAAAACT TTTGACAGAGTTCGATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910044: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100441906109AA269077MA1MA012.AA3S. mansoni adult Lambda Zap


Date: 21:19:51 on Sun 19 Nov 117.