EST 910055 is a singleton


Sequence

>910055 (1 EST) Length=163 AGTTATTCTTGTGTCCTCTCCTATATATGTGTATTTTTCATTCCTCAACTATTGCTCATCAGTATATAGTTACACTATAG CAGTATTACAAACAATAGTAATAGATCTTACTAGGTAAAAGCTTAGCAAGGAGGTGTACAACACAAAATTGATTTTTCTT TCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910055: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100551906120AA269088MA1MA023.AA3S. mansoni adult Lambda Zap


Date: 23:38:41 on Fri 17 Nov 117.