EST 910061 is a singleton


Sequence

>910061 (1 EST) Length=210 GAAAAACGTGCAGGTAAAGGTGATTCTGATACATTCATAAAAATTTTAACAAAACGAAGTAAATATCATGTAAAAGAAAT ATGGGATCTATATTTAGCGAAATACCATATACATAGTTGAAGTTATATCGAAAAAATCTCAGACCATTTAGATCAGGGTT AATACATGATATGCATGATGATTACGCGTGTAATAGTTGTCATGATGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910061: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100611906126AA269094MA1MA029.AA3S. mansoni adult Lambda Zap


Date: 1:45:10 on Sun 19 Nov 117.