EST 910062 is a singleton


Sequence

>910062 (1 EST) Length=192 ATTTAATAGTTTACATTAGGGCTCCTATCGAGCAAATACGTGAAAAAATAAAGAAACGTAATATCCCTTGGGAGGTAAAT GCACGCAATCTAACGGATGAATTTTTAAATGCTTATGAAGATATACTTGGAAATTATTATATAGAAAATATGGACCGTTA CTCTCATATCATACTGTTGATGCTTCAACAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910062: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100621906127AA269030MA1MA030.AA3S. mansoni adult Lambda Zap


Date: 7:6:19 on Mon 20 Nov 117.