EST 910069 is a singleton


Sequence

>910069 (1 EST) Length=178 ATGAATTCAATATACCAAGAACTAGATCAGATGATGTTTTTACAACTAGAGATTTGAGTACTCTAATTTATATCATCCAT TTAATATATTACCTGATACTAGAGTGTATCATGTACTCGATTGATATACATCACATATATATGATATGATATCATAGATC GAGTGCTGAATGTGCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910069: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100691906134AA269037MA1MA037.AA3S. mansoni adult Lambda Zap


Date: 23:51:10 on Fri 17 Nov 117.