EST 910070 is a singleton


Sequence

>910070 (1 EST) Length=201 TTTCAAATGGAACGAAATACAATCCTTTCGTCCAGATTATTTTCAAAAACATCATGCATCGAATAAACGTTTGACTCGTA CATTTTCAGATGATTCTGTAGTTAATGTTCGACAGTTTGATGTTGGATATCAGCATTATGTGCTTATCCAAGTTCACCAC ATAACATTCTCAATTTATACCGATTCAACCAGATATAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910070: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100701906135AA269038MA1MA038.AA3S. mansoni adult Lambda Zap


Date: 13:32:10 on Wed 22 Nov 117.