EST 910072 is a singleton


Sequence

>910072 (1 EST) Length=241 ATTTTTTGAGTGGCGCAGATGGTCATCGAGAAATCGAGTTTTTCTTCGCTAGTTGTGCAAGTGCATTAATTGTTCATACT GACAAAGTTATTTTTCTAGAAGATGATGATGTAGCGGCTGTTCGTAATGGTCAACTGACAATTCATCGTTTATCAAGAAG TGCATCAGCGACACGTGAAGTTGTTACTTTACAAATGGAATTGCAACAAATAATGAAAGGTAATTATGATTTATTTTATG C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910072: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100721906137AA269040MA1MA040.AA3S. mansoni adult Lambda Zap


Date: 0:42:3 on Thu 23 Nov 117.