EST 910079 is a singleton


Sequence

>910079 (1 EST) Length=251 AATAGTTGGCTCTGGAAATGTTTAATAAATGAGAATTGTGAAAAATATACATGTATACTTGTTACTTCTGAATTATCACT ACAAACTCTTGAGAATTCTCATCAGTCACTTAANNNACTGCATACTAATAATTATGAAACTACTGAAAGTCTTGTAAATA AGCTGTCAAAACTATCCTGTGCTGTTAAAAAACAGAACGATCAACAAACATTTATCTTCATAGAGTCATTATCAAGGTTT TTAATTGATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910079: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100791906144AA269047MA1MA047.AA3S. mansoni adult Lambda Zap


Date: 18:9:31 on Fri 17 Nov 117.