EST 910083 is a singleton


Sequence

>910083 (1 EST) Length=250 ATTCTCTCCAGGATTATTATCCTCTATGTGTTACATAAGTTTCGCATTATATTTTTATGATTTCATACAACCTTCAACGA CTTCTACCATTCACTATCCATCAATCAATCAGATTTTTTCAAAAGTTGAAGAAATTGAAGATCCGAAGAATAAAGTATTC AATGAAACTGAACCAGAGACATTAATGATCAGTCAGTAAGATCGGGTCTTTTTAGAAGATCTAGACGAAATGATAATGGA TAAACATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910083: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100831906148AA269051MA1MA051.AA3S. mansoni adult Lambda Zap


Date: 12:40:7 on Tue 21 Nov 117.