EST 910084 is a singleton


Sequence

>910084 (1 EST) Length=185 CAATATTAATAATGATAACTGTAATAATAATAATGATTGTAATATAGAATATAATATACCTTCTTATACATTAGATTGTC GACCTAATTTTGATGGTTTTACATCATTTACAAATTATAGAGCATGGAGTCATTACTCTGGTGAAACAAACTATTATTAA TATATATATTAGATGTAATAGACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910084: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100841906149AA269052MA1MA052.AA3S. mansoni adult Lambda Zap


Date: 10:35:41 on Tue 21 Nov 117.