EST 910090 is a singleton


Sequence

>910090 (1 EST) Length=245 AATCAATCAGATGTAGATGATAACGGGAATTAATCAAGAAAATATGGAACGAAACATAGAACAAGAAAATGCTATAAGTC ATGATGAAGCTCGCAAACGGATAACGTTCGTTACCAGTCTGCATGCTCGTTTTAGTGGTTACGATTTCGACAGAAAAAAT TCANNNCCGAAGTGGGCTCGTCTTACAATTTGTATGTTCGATCCAAAAAGAAGGACGTATATCTATGACCTAGAAACTTT AATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910090: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100901906155AA269058MA1MA058.AA3S. mansoni adult Lambda Zap


Date: 16:11:18 on Sun 19 Nov 117.