EST 910096 is a singleton


Sequence

>910096 (1 EST) Length=267 TATTTCAGGTAGTTCTTATTTTTAAGCATTATTGCGGAGTAGAAATTTATGTAATCGGTTTAAATTACAGTTAGTTCTTA GGAAATATATATACATCAATAAGGTCTAATAAAGATTTGTTTTTTTCATGATCCGAAGAAATTCTTGTTCGTTGACTTCA CCATCACCATCGCGATCAGCCTCATCAATCATTTCTTGCAACTCCNCGTCAGTAAGATTTTCACCAAGTTCTTTCGCCAC ACGCTTAAGGTTTTTGAAAGATATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 910096: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100961906161AA269064MA1MA064.AA3S. mansoni adult Lambda Zap


Date: 4:22:7 on Fri 24 Nov 117.