EST 910110 is a singleton


Sequence

>910110 (1 EST) Length=191 CCCAAGTTTGAGNNNTGAAAGATGAGANATGAAATGAAAGAAAGAAAGAAAAAGAAAGAAATGGAAAATAAACACTCGGA AGAGATCTAAACAGTCATGCTAAACAATCCTCATTTGAAGTTATATCTTTTACCCTGTACGTCTTGAAGTCGAATATCGA TAGGTGATATGATCTCCTTCTCGTACATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 910110: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9101101906175AA269113KJ4SLB038T3JHU93SL-BmL4 (JHU)


Date: 4:37:54 on Wed 22 Nov 117.